Global genetic diversity, introgression, and evolutionary adaptation of indicine cattle revealed by whole genome sequencing.

Indicine cattle, also referred to as zebu (Bos taurus indicus), play a central role in pastoral communities across a wide range of agro-ecosystems, from extremely hot semiarid regions to hot humid tropical regions. However, their adaptive genetic changes following their dispersal into East Asia from the Indian subcontinent have remained poorly documented. Here, we characterize their global genetic diversity using high-quality whole-genome sequencing data from 354 indicine cattle of 57 breeds/populations, including major indicine phylogeographic groups worldwide. We reveal their probable migration into East Asia was along a coastal route rather than inland routes and we detected introgression from other bovine species. Genomic regions carrying morphology-, immune-, and heat-tolerance-related genes underwent divergent selection according to Asian agro-ecologies. We identify distinct sets of loci that contain promising candidate variants for adaptation to hot semi-arid and hot humid tropical ecosystems. Our results indicate that the rapid and successful adaptation of East Asian indicine cattle to hot humid environments was promoted by localized introgression from banteng and/or gaur. Our findings provide insights into the history and environmental adaptation of indicine cattle.

mRNA sequencing provides new insights into the pathogenesis of Hirschsprung's disease in mice.

PURPOSE: The aim of this study is to use RNA sequencing and RT-qPCR to identify the main susceptibility genes linked to the occurrence and development of Hirschsprung disease in the colonic tissues of EDNRBm1yzcm and wild mice. METHODS: RNA was extracted from colon tissues of 3 mutant homozygous mice and 3 wild mice. RNA degradation, contamination concentration, and integrity were then measured. The extracted RNA was then sequenced using the Illumina platform. The obtained sequence data are filtered to ensure data quality and compared to the reference genome for further analysis. DESeq2 was used for gene expression analysis of the raw data. In addition, graphene oxide enrichment analysis and RT-qPCR validation were also performed. RESULTS: This study identified 8354 differentially expressed genes in EDNRBm1yzcm and wild mouse colon tissues by RNA sequencing, including 4346 upregulated genes and 4005 downregulated genes. Correspondingly, the results of RT-qPCR analysis showed good correlation with the transcriptome data. In addition, GO and KEGG enrichment results suggested that there were 8103 terms and 320 pathways in all DEGs. When P < 0.05, 1081 GO terms and 320 KEGG pathways reached a significant level. Finally, through the existing studies and the enrichment results of differentially expressed genes, it was determined that axon guidance and the focal adhesion pathway may be closely related to the occurrence of HSCR. CONCLUSIONS: This study analyzed and identified the differential genes in colonic tissues between EDNRBm1yzcm mice and wild mice, which provided new insight for further mining the potential pathogenic genes of Hirschsprung's disease.

Global dispersal and adaptive evolution of domestic cattle: a genomic perspective.

Domestic cattle have spread across the globe and inhabit variable and unpredictable environments. They have been exposed to a plethora of selective pressures and have adapted to a variety of local ecological and management conditions, including UV exposure, diseases, and stall-feeding systems. These selective pressures have resulted in unique and important phenotypic and genetic differences among modern cattle breeds/populations. Ongoing efforts to sequence the genomes of local and commercial cattle breeds/populations, along with the growing availability of ancient bovid DNA data, have significantly advanced our understanding of the genomic architecture, recent evolution of complex traits, common diseases, and local adaptation in cattle. Here, we review the origin and spread of domestic cattle and illustrate the environmental adaptations of local cattle breeds/populations.

Analysis of lncRNA and mRNA expression profiling in immature and mature DeZhou donkey (equine Taurus) testes.

Testicular development and spermatogenesis are tightly regulated by the number of genes and noncoding genes, and mRNAs and lncRNAs play vital roles in regulating posttranscriptional gene expression. However, mRNAs and lncRNAs have not been systematically identified in the testes of donkeys. In this study, mRNA and lncRNA expression profiles in the testes of DeZhou donkeys between 2 months and 2 years of age were comprehensively analysed by RNA sequencing. We identified 56,605 lncRNAs and 61,857 mRNAs by gene expression analysis, and 21,845 lncRNAs (p < .05) and 14,109 mRNAs (p < .05) were differentially expressed in the immature (2-month-old, n = 3, noADGW) and mature (2-year-old, n = 3, ADGW) stages. In addition, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses revealed that the predicted target genes were enriched in the adherens junction, cell cycle, propanoate metabolism and cell adhesion molecule pathways. This study identified and analysed a comprehensive catalogue of lncRNAs and mRNAs in donkey testes, which provides a useful resource for further investigation of biological function in donkey lncRNAs.

Association analysis of IGF2 gene polymorphisms with growth traits of Dezhou donkey.

IGF2 is an insulin-like growth factor that plays an important role in the development of animal embryos. In order to determine whether IGF2 gene is associated with important economic characteristics of donkeys, we investigated the association between single nucleotide polymorphisms (SNPs) of IGF2 gene and body size traits of Chinese Dezhou donkeys and analyzed the expression level of IGF2 gene in different tissues of juvenile and adult Dezhou donkeys. In this study, two SNPs (g.281766 G > A and g.291322 C > T) were detected in IGF2 gene, both of which were in Hardy-Weinberg equilibrium (P > 0.05) and were moderately polymorphic (0.25 < PIC < 0.50). Association analysis showed that the two SNP loci were significantly correlated with body length and rump height (p < 0.05) of female Dezhou donkeys. Quantitative results showed that the expression of IGF2 gene was higher in heart, liver, spleen, lung, kidney, stomach and muscle tissues of juvenile donkeys than that of adult donkeys. Together, IGF2 can be considered as a candidate gene for growth and development of female Dezhou donkey, and its polymorphism can be used as a molecular marker for the Dezhou donkey breeding.

Comparative transcriptomics analysis of testicular miRNA from indicine and taurine cattle.

Numerous studies have shown that several microRNAs (miRNAs) are specifically expressed in testis, play an essential role in regulating testicular spermatogenesis. Hainan and Mongolian cattle are two representative Chinese native cattle breeds representing Bos indicus (indicine cattle) and Bos taurus (taurine cattle), respectively, which are distributed in hot Hainan and cold Inner Mongolia province. To study the functional differences of miRNA in spermatogenesis between indicine and taurine cattle, six mature testes samples from indicine cattle (n = 3) and taurine cattle (n = 3) were collected, respectively. We detected miRNA expression using small RNA sequencing technology following bioinformatic analysis. A total of 578 known miRNAs and 132 novel miRNAs were detected in the six libraries. Among the 710 miRNAs, 564 miRNAs were expressed in both indicine and taurine cattle, 73 miRNAs were found solely in indicine cattle and 73 miRNAs were found solely in taurine cattle. After further analysis, among the miRNAs were identified in both indicine and taurine cattle, 184 miRNAs were differentially expressed (|log2 fold change| ≥ 1 and corrected p-value <0.05). Among the miRNAs that were only expressed in indicine cattle, 10 miRNAs were differentially expressed, whereas, among the miRNAs that were only expressed in taurine cattle, six miRNAs were differentially expressed. The enrichment analysis result showed that predicted target genes of a total of 200 differentially expressed miRNAs were enriched on some testicular spermatogenesis-related Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways, especially mitogen-activated protein kinase (MAPK) signaling pathway. These findings identify miRNAs as key factors to regulate spermatogenesis in both indicine and taurine cattle, which may also be helpful for improving cattle reproductive performance in future studies.

A novel 31bp deletion within the CDKL5 gene is significantly associated with growth traits in Dezhou donkey.

The discovery of molecular markers which associate with livestock economic traits is of great significance for livestock breeding. Selective analysis has found a potential correlation between CDKL5 and growth traits, but there is still a lack of experimental proof. In this study, a 31-bp deletion (g.176595_176626delATGTCACATGTGGTACTGCCATGTGGAATTT) of CDKL5 gene was found by sequencing. The 31-bp indel was then genotyped in 380 individuals of Dezhou donkeys by polyacrylamide gel electrophoresis and there were three genotypes in this population. After the association analysis between growth traits and genotypes, it was found that this 31-bp indel polymorphism was significantly associated with the chest circumference of Dezhou donkeys (p < 0.05), and body length, chest depth and rump width (p < 0.01). In addition, all individuals with DD genotype were better than those with other genotypes in growth traits. This study revealed that a newly identified polymorphic locus in the CDKL5 gene is related to growth traits, which provides a molecular marker for genetic improvement of Dezhou donkey and may lay a solid foundation for the breeding of Dezhou donkey.

Metabolic changes before and after weaning in Dezhou donkey foals in relation to gut microbiota.

Weaning is undoubtedly one of the most crucial stages in the growth and development of all mammalian animals, including donkey foals. Weaning is a dynamic and coordinated process of the body, which is closely associated with the health, nutrition, and metabolism of the host. Many studies have shown that the intestinal microbiota and serum metabolites of mammals exhibit different changes during lactation, weaning, and postweaning. However, the alterations in serum metabolites in donkey foals before and postweaning and the correlation between serum metabolites and intestinal microbiota are largely unknown. This study is based on the fecal 16S rRNA and serum metabolomes of Dezhou donkey foals. In total, 10 samples (fecal and serum) were collected during the following three stages: before weaning (F.M.1), during weaning (F.M.3), and postweaning (F.M.6). To study the alterations in intestinal microflora, serum metabolites, and their correlation before and postweaning. We found that with the growth and weaning progress of donkey foals, the intestinal microbiota of donkey foals underwent obvious changes, and the diversity of fecal bacteria increased (Chao1 and Shannon indexes). The main intestinal microbial flora of donkey foals include Bacteroides and Firmicutes. We found many microbiota that are associated with immunity and digestion in the postweaning group, such as Verrucomicrobiales, Clostridia, Oscillospiraceae, Akkermansia, and Rikenellaceae, which can be considered microbial markers for the transition from liquid milk to solid pellet feed. Clostridia and Oscillospiraceae can produce organic acids, including butyric acid and acetic acid, which are crucial for regulating the intestinal microecological balance of donkeys. Furthermore, the metabolome showed that the serum metabolites enriched before and postweaning were mainly related to arachidonic acid metabolism and riboflavin metabolism. Riboflavin was associated with the development of the small intestine and affected the absorption of the small intestine. We also found that the changes in the gut microbiome of the foals were significantly correlated with changes in serum metabolites, including lysophosphatidylcholine (LPC; 12,0) and positively correlated with Lachnoclostridium and Roseburia. To summarize, this study provides theoretical data for the changes in the intestinal microbiome and serum metabolism during the entire weaning period of donkey foals.

Genome-wide analysis reveals selection signatures for body size and drought adaptation in Liangzhou donkey.

Liangzhou donkey is a domestic animal breed distributed on the edge of the Tengger Desert in Gansu Province of China. It has small body size and strong adaptability to dry environments. Here, we sequenced 10 Liangzhou donkey genomes and compared them to the 55 genomes of 8 representative donkey breeds worldwide. The population structure analysis revealed that Liangzhou donkey harboured the ancestry with the Asian domestic donkeys (0.863) and European domestic donkeys (0.137). Three methods (nucleotide diversity, linkage disequilibrium decay and runs of homozygosity) implied the genetic diversity in Liangzhou donkey. In addition, we analyzed the genetic basis of the small body size and drought adaptation of Liangzhou donkey by using Fst, θπ-ratio, XP-EHH, CLR and θπ methods. We found that the NCAPG-LCORL on chromosome 3 may be a candidate region for small body size trait of Liangzhou donkey. The CYP4A11 gene located on chromosome 5 showed strong sign of selection sweep. CYP4A11 can convert arachidonic acid into 19(S)-HETE, which can promote water reabsorption in renal tubule and enhance the ability of Liangzhou donkey to adapt to dry environment. These results contribute to a better understanding of the underlying population structure of Liangzhou donkeys and provides a valuable resource for future research on donkey breeding in response to climate change.

Assessing the Role of Ancestral Fragments and Selection Signatures by Whole-Genome Scanning in Dehong Humped Cattle at the China-Myanmar Border.

Dehong humped cattle are precious livestock resources of Yunnan Province, China; they have typical zebu traits. Here, we investigated their genetic characteristics using whole-genome resequencing data of Dehong humped animals (n = 18). When comparing our data with the publicly-available data, we found that Dehong humped cattle have high nucleotide diversity. Based on clustering models in a population structure analysis, Dehong humped cattle had a mutual genome ancestor with Chinese and Indian indicine cattle. While using the RFMix method, it is speculated that the body sizes of Dehong humped cattle were influenced by the Chinese indicine segments and that the immune systems of Dehong humped cattle were affected by additional ancestral segments (Indian indicine). Furthermore, we explored the position selection regions harboring genes in the Dehong humped cattle, which were related to heat tolerance (FILIP1L, ABHD6) and immune responses (GZMM, PRKCZ, STOML2, LRBA, PIK3CD). Notably, missense mutations were detected in the candidate gene ABHD6 (c.870C>A p.Asp290Glu; c.987C>A p.Ser329Arg). The missense mutations may have implications for Dehong humped cattle adaptation to hot environments. This study provides valuable genomic resource data at the genome-wide level and paves the way for future genetic breeding work in the Dehong humped cattle.

Changes in sperm metabolites of Dezhou donkey after cryopreservation.

Sperm cryopreservation technology has laid the foundation for promoting the popularity of artificial insemination in donkey reproduction, but the freeze-thaw process can cause sperm damage, and the viability of frozen sperm is greatly reduced, resulting in low insemination ability. Sperm metabolites play an important role in the freezing process of spermatozoa and have a major influence on the freezability of spermatozoa. The aim of this study was to explore the differential metabolites in donkey spermatozoa before and after cryopreservation by liquid chromatography-tandem mass spectrometry (LC-MS/MS). We analysed ejaculate samples from male donkeys obtained before and after freezing and identified 1323 metabolites. Compared with fresh sperm (F), the metabolites of cryopreserved sperm (CRY) were significantly changed, and 570 metabolites were significantly different between the two groups (p < .05). Among them, 277 metabolites were higher in frozen sperm, while the opposite was true for 293 metabolites. These metabolites mainly include phospholipids, lysophospholipids and amino acids., most of which are associated with oxidative stress and sperm capacitation. We describe significantly different metabolites before and after freezing that are significantly associated with decreased sperm motility post-freezing and can be used as biomarkers of decreased sperm motility post-freezing.

Whole Genome Sequencing Provides New Insights Into the Genetic Diversity and Coat Color of Asiatic Wild Ass and Its Hybrids.

The diversity of livestock coat color results from human positive selection and is an indispensable part of breed registration. As an important biodiversity resource, Asiatic wild ass has many special characteristics, including the most visualized feature, its yellowish-brown coat color, and excellent adaptation. To explore the genetic mechanisms of phenotypic characteristics in Asiatic wild ass and its hybrids, we resequenced the whole genome of one Mongolian Kulan (a subspecies of Asiatic wild ass) and 29 Kulan hybrids (Mongolian Kulan ♂×Xinjiang♀), and the ancestor composition indicated the true lineage of the hybrids. XP-EHH (Cross Population Extended Haplotype Homozygosity), θπ-ratio (Nucleotide Diversity Ratio), CLR (Composite Likelihood Ratio) and θπ (Nucleotide Diversity) methods were used to detect the candidate regions of positive selection in Asiatic wild ass and its hybrids. Several immune genes (DEFA1, DEFA5, DEFA7, GIMAP4, GIMAP1, IGLC1, IGLL5, GZMB and HLA) were observed by the CLR and θπ methods. XP-EHH and θπ-ratio revealed that these genes are potentially responsible for coat color (KITLG) and meat quality traits (PDE1B and MYLK2). Furthermore, the heatmap was able to show the clear difference in the haplotype of the KITLG gene between the Kulan hybrids and Asiatic wild ass group and the Guanzhong black donkey group, which is a powerful demonstration of the key role of KITLG in donkey color. Therefore, our study may provide new insights into the genetic basis of coat color, meat quality traits and immunity of Asiatic wild ass and its hybrids.

Metabolomic profiling of Dezhou donkey seminal plasma related to freezability.

Donkeys are indispensable livestock in China because they have transport function and medicinal value. With the popularization of artificial insemination on donkeys, semen cryopreservation technology has gradually become a research hotspot. Seminal plasma is a necessary medium for transporting sperm and provides energy and nutrition for sperm. Seminal plasma metabolites play an important role in the process of sperm freezing, and also have an important impact on sperm motility and fertilization rate after freezing and thawing. In this study, liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis was used to compare the metabolic characteristics of seminal plasma of high freezability (HF) and low freezability (LF) male donkeys. We identified 672 metabolites from donkey seminal plasma, of which 33 metabolites were significantly different between the two groups. Metabolites were identified and categorized according to their major chemical classes, including homogeneous non-metal compounds, nucleosides, nucleotides, and analogues, organosulphur compounds, phenylpropanoids and polyketide, organoheterocyclic compounds, organic oxygen compounds, benzenoids, organic acids and derivatives, lipids and lipid-like molecules, organooxygen compounds, alkaloids and derivatives, organic nitrogen compounds. The results showed that the contents of phosphatidylcholine, piceatannol and enkephalin in donkey semen of HF group were significantly higher than those of LF group (p < .05), while the contents of taurocholic and lysophosphatidic acid were significantly lower than those of LF group (p < .05). The different metabolites were mainly related to sperm biological pathway response and oxidative stress. These metabolites may be considered as candidate biomarkers for different fertility in jacks.

MiR-24-3p Conservatively Regulates Muscle Cell Proliferation and Apoptosis by Targeting Common Gene CAMK2B in Rat and Cattle.

Skeletal muscle plays an important role in the growth and development of meat animals. MicroRNAs (miRNAs) can participate in the regulation of muscle development-related functions; however, there have been few reports on whether there are related miRNAs that conservatively regulate muscle development among different species. In this study, the miRNA transcriptome sequencing data of the muscle tissue of cattle, rat, goat, and pig showed that miR-24-3p may conservatively regulate muscle development in these species. Furthermore, mmu-miR-24-3p can positively regulate C2C12 cell proliferation and apoptosis by regulating key proliferation and apoptosis genes in muscle development, which was verified by CCK-8 and RT-qPCR. Bta-miR-24-3p can also positively regulate the proliferation and apoptosis of bovine muscle primary cells by regulating key proliferation and apoptosis genes in the process of muscle development, as verified by CCK-8 and RT-qPCR. The target genes of miR-24-3p in cattle, rat, goat, and pig, which include a large proportion of target genes shared among the four species, are enriched in multiple cell functions and signal pathways that are closely related to muscle development, as revealed by GO and KEGG enrichment analysis. A double luciferase test showed that the shared target genes WNT4, CAMK2B, and TCF7 were targeted by mmu-miR-24-3p in rat and bta-miR-24-3p in cattle. These three shared target genes WNT4, CAMK2B, and TCF7 are involved in the Wnt signaling pathway, which showed that miR-24-3p plays an important role in rat and cattle. The shared target gene (CAMK2B) in rat and cattle increased significantly after the inhibition of miR-24-3p by RT-qPCR. The findings of this study contribute to a better understanding of the role of miR-24-3p in the regulation of muscle development.

Metabolomic profiling of Dezhou donkey sperm associated with freezability.

The cryopreservation technology of sperm has promoted the popularization of artificial insemination in the reproductive process of donkeys to a certain extent, but the freezing-thawing process would bring damage to the sperm, and the vitality of the sperm would be greatly reduced after freezing. Sperm metabolites play an important role in the process of sperm freezing, and also have an important impact on the vitality and fertilization rate of sperm after freezing-thawing. In this study, the LC-MS/MS analysis method was used to compare the metabolic profiles of high freezability (HF) and low freezability (LF) male donkey sperm after freezing-thawing. We identified 1323 metabolites in total, of which 17 metabolites are significantly different between the two groups. Most of these metabolites belong to fatty acids and phospholipids, including phosphatidylcholine, stearic acid and so on. These different metabolites are mostly related to the plasma membrane fatty acids of sperm and oxidative stress. Our results illustrate several metabolites related to sperm freezability and provide corresponding biomarkers.

Whole-genome resequencing reveals genetic diversity, differentiation, and selection signatures of yak breeds/populations in Qinghai, China.

The Qinghai Province of China is located in the northeast region of the Qinghai-Tibetan Plateau (QTP) and carries abundant yak genetic resources. Previous investigations of archaeological records, mitochondrial DNA, and Y chromosomal markers have suggested that Qinghai was the major center of yak domestication. In the present study, we examined the genomic diversity, differentiation, and selection signatures of 113 Qinghai yak, including 42 newly sequenced Qinghai yak and 71 publicly available individuals, from nine yak breeds/populations (wild, Datong, Huanhu, Xueduo, Yushu, Qilian, Geermu, Tongde, and Huzhu white) using high-depth whole-genome resequencing data. We observed that most of Qinghai yak breeds/populations have abundant genomic diversity based on four genomic parameters (nucleotide diversity, inbreeding coefficients, linkage disequilibrium decay, and runs of homozygosity). Population genetic structure analysis showed that Qinghai yak have two lineages with two ancestral origins and that nine yak breeds/populations are clustered into three distinct groups of wild yak, Geermu yak, and seven other domestic yak breeds/populations. F ST values showed moderate genetic differentiation between wild yak, Geermu yak, and the other Qinghai yak breeds/populations. Positive selection signals were detected in candidate genes associated with disease resistance (CDK2AP2, PLEC, and CYB5B), heat stress (NFAT5, HSF1, and SLC25A48), pigmentation (MCAM, RNF26, and BOP1), vision (C1QTNF5, MFRP, and TAX1BP3), milk quality (OPLAH and GRINA), neurodevelopment (SUSD4, INSYN1, and PPP1CA), and meat quality (ZRANB1), using the integrated PI, composite likelihood ratio (CLR), and F ST methods. These findings offer new insights into the genetic mechanisms underlying target traits in yak and provide important information for understanding the genomic characteristics of yak breeds/populations in Qinghai.

Design, Preparation, and Bioactivity Study of New Fusion Protein HB-NC4 in the Treatment of Osteoarthritis.

Osteoarthritis (OA) is now becoming the main disease that affects public health. There is no specific medicine used for OA in clinical application until now. Recently, several studies demonstrated that OA is closely related to the complement system, and some complement regulators such as N-terminal non-collagenous domain 4 (NC4) aimed at alleviating OA have shown a promising therapeutic effect. However, targeting ability is the main limitation for NC4. In this study, a fusion protein named heparin-binding domain-N-terminal non-collagenous domain 4 (HB-NC4) was proposed to solve this problem, which could provide a better way for OA treatment. First, HB-NC4 plasmid was constructed using ClonExpress II one-step ligation kit method. And Escherichia coli BL21 was utilized to express the fusion protein, Ni2+-sepharose, and a desalting gravity column were introduced to purify HB-NC4. The results showed that 0.84 mg HB-NC4 could be obtained from a 1 L culture medium with a purity higher than 92.6%. Then, the hemolytic assay was introduced to validate the anti-complement activity of HB-NC4; these results demonstrated that both HB-NC4 and NC4 had a similar anti-complement activity, which indicated that heparin-binding (HB) did not affect the NC4 structure. Targeting ability was investigated in vivo. HB-NC4 showed a higher affinity to cartilage tissue than NC4, which could prolong the retention time in cartilage. Finally, the destabilization of the medial meniscus (DMM) model was applied to investigate HB-NC4 pharmacodynamics in vivo. The results indicated that HB-NC4 significantly slowed cartilage degradation during the OA process. In summary, compared with NC4, HB-NC4 had better-targeting ability which could improve its therapeutic effect and prolonged its action time. It could be used as a new complement regulator for the treatment of OA in the future.

A Rise in ROS and EPS Production: New Insights into the Trichodesmium erythraeum Response to Ocean Acidification.

The diazotrophic cyanobacterium Trichodesmium is thought to be a major contributor to the new N in parts of the oligotrophic, subtropical, and tropical oceans. In this study, physiological and biochemical methods and transcriptome sequencing were used to investigate the influences of ocean acidification (OA) on Trichodesmium erythraeum (T. erythraeum). We presented evidence that OA caused by CO2 slowed the growth rate and physiological activity of T. erythraeum. OA led to reduced development of proportion of the vegetative cells into diazocytes which included up-regulated genes of nitrogen fixation. Reactive oxygen species (ROS) accumulation was increased due to the disruption of photosynthetic electron transport and decrease in antioxidant enzyme activities under acidified conditions. This study showed that OA increased the amounts of (exopolysaccharides) EPS in T. erythraeum, and the key genes of ribose-5-phosphate (R5P) and glycosyltransferases (Tery_3818) were up-regulated. These results provide new insight into how ROS and EPS of T. erythraeum increase in an acidified future ocean to cope with OA-imposed stress.

Responses of triacylglycerol synthesis in Skeletonema marinoi to nitrogen and phosphate starvations.

Skeletonema marinoi is one of the most widespread marine planktonic diatoms in temperate coastal regions and sometimes can form massive blooms. Yet, the molecular mechanisms of triacylglycerol (TAG) synthesis in nutrient-deficient conditions for this species are still unknown. This study aimed to investigate how the TAG biosynthetic pathway of S. marinoi reacts to the culture age and nitrogen (N) or phosphorus (P) deficiency at molecular levels. Meanwhile, we also described the physiological and biochemical changes of S. marinoi in response to N or P starvation over time. To obtain reliable qRT-PCR data, six putative reference genes were identified for assessing expression stability using geNorm and BestKeeper software, and Actin exhibited the most stable expression across 45 tested S. marinoi samples. We found that the expression of TAG biosynthesis-related genes and ACCase enzyme activity varied in response to the different nutrient conditions and culture age. Taken together, we speculated that the capacity of TAG biosynthesis in S. marinoi is induced by N or P stress, and increases with culture age. Furthermore, TAG biosynthesis appears to respond more strongly to P deficiency than to N deficiency. Our study provides important insights into how diatoms regulate the TAG biosynthetic pathway when stressed by nutrient limitation. Besides, the data obtained from this study also provide useful clues for further exploring genes that can be used for metabolic engineering to enhance lipid production.

The functional role of the EZH2 gene in controlling breast cancer stem cells.

PURPOSE: Breast cancer is caused by rare populations of self-renewing cancer stem cells that might also play a role in tumor relapse. Genes that regulate cancer stem cells are, therefore, of great interest in controlling cancer. EZH2 gene expression is reported to be elevated during breast cancer progression and it plays a role in expanding breast stem cell populations. In the current study, we analyzed the correlation between the silencing effect of EZH2 and breast cancer stem cell expansion. METHODS: We used CD44+/CD24-/low cells to develop initial-, moderate-, and advanced-stage breast cancers in female NOD/SCID mice. Immunohistochemistry and western blotting were used to study the expression of aldehyde dehydrogenase 1 (ALDH1) and EZH2 in different stages of breast cancer. RESULTS: Histology showed that as tumors progressed, the pathological condition changed exhibiting enlarged nuclei, higher cell proliferation, and more invasive cells. In EZH2-silenced mice histopathology also showed enlarged cell nucleus, lesion formation and cell aggregation. Immunohistochemistry and western blotting analyses of EZH2 and ALDH1 demonstrated elevated expression as tumors progressed to the next level. Interestingly, the expression of ALDH1 in EZH2-silenced breast cancer tissue showed prolonged overexpression. CONCLUSIONS: We conclude that the normal expression of EZH2 in cancer tissue controls cancer stem cell expansion, because it is highly elevated in EZH2-silencing cancer tissue.